Table I:

No.

Relative Transcription Level (RTL)

R1

3.8690

R2

3.6919

R3

3.8870

R4

4.8404

R5

3.8465

R6

3.5799

R7

3.5703

R8

6.7307

R9

3.7589

R10

3.6896

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 


Table II:

 

1210 residues in    10 sequences

 results sorted and z-values calculated from opt score

   10 scores better than 1 saved, ktup: 6, fact: 6

 DNA matrix, gap penalties: -16,-4

 joining threshold: 46, optimization threshold: 31, width: 16

  scan time:  0:00:00

The best scores are:                             initn init1 opt

R6, 121 bases, 34DF602C checksum.                  555 555  555

R10, 121 bases, 1203C265 checksum.                 535 535  537

R9, 121 bases, EA1BF176 checksum.                  492 492  492

R7, 121 bases, BC9B2289 checksum.                  453 453  470

R3, 121 bases, 492F8031 checksum.                  461 461  461

R1, 121 bases, ACD08F2C checksum.                  450 450  452

R2, 121 bases, C5BA8B94 checksum.                  417 417  438

R5, 121 bases, A7CC5C50 checksum.                  363 363  401

R8, 121 bases, F8B2CAAC checksum.                  365 365  380

R4, 121 bases, A6543FA4 checksum.                  286 286  326

>>R6, 121 bases, 34DF602C checksum.                  (121 nt)

initn:  555  init1:  555  opt:  555

  95.8% identity in 120 nt overlap

 

               10        20        30        40        50        60

glo,   CGTAGAGCCACACCCTGGTAAGGGCCAATCTGCTCACACAGGATAGAGAGGGCAGGAGCC

       X::::::::::::::::::::: :::::::::::::::: : ::::::::::::: ::::

R6,    CGTAGAGCCACACCCTGGTAAGCGCCAATCTGCTCACACTGTATAGAGAGGGCAGAAGCC

               10        20        30        40        50        60

                            

               70        80        90       100       110       120

glo,   AGGGCAGAGCATATAAGGTGAGGTAGGATCAGTTGCTCCTCACATTTGCTTCTGACATAG

       ::: :::::::::::::::::::::::::::::::::::::::::::::::::::::::X

R6,    AGGACAGAGCATATAAGGTGAGGTAGGATCAGTTGCTCCTCACATTTGCTTCTGACATAG

               70        80        90       100       110       120

                  

glo,   T

        

R6,    G

       

>>R10, 121 bases, 1203C265 checksum.                 (121 nt)

initn:  535  init1:  535  opt:  537

  94.2% identity in 120 nt overlap

 

               10        20        30        40        50        60

glo,   CGTAGAGCCACACCCTGGTAAGGGCCAATCTGCTCACACAGGATAGAGAGGGCAGGAGCC

        ::  X::::::::::::::::::::::::::::::::::::::: :::: :::: ::::

R10,   AGTTAAGCCACACCCTGGTAAGGGCCAATCTGCTCACACAGGATACAGAGTGCAGAAGCC

               10        20        30        40        50        60

 

               70        80        90       100       110       120

glo,   AGGGCAGAGCATATAAGGTGAGGTAGGATCAGTTGCTCCTCACATTTGCTTCTGACATAG

        ::::::::::::::::::::::::::::::::::::::::::::::::::::: :::::

R10,   GGGGCAGAGCATATAAGGTGAGGTAGGATCAGTTGCTCCTCACATTTGCTTCTGTCATAG

               70        80        90       100       110       120

     

glo,   T

       X

R10,   T

       

 

>>R9, 121 bases, EA1BF176 checksum.                  (121 nt)

initn:  492  init1:  492  opt:  492

  90.0% identity in 120 nt overlap

 

               10        20        30        40        50        60

glo,   CGTAGAGCCACACCCTGGTAAGGGCCAATCTGCTCACACAGGATAGAGAGGGCAGGAGCC

        X::::: ::::: : :  ::: ::::::::::::::::::::::::::: :::::::::

R9,    TGTAGAGGCACACGCGGTGAAGAGCCAATCTGCTCACACAGGATAGAGAGCGCAGGAGCC

               10        20        30        40        50        60

 

               70        80        90       100       110       120

glo,   AGGGCAGAGCATATAAGGTGAGGTAGGATCAGTTGCTCCTCACATTTGCTTCTGACATAG

       : :::::::::::::::::: :::::::: :::::::::::::::: ::::::: :::::

R9,    ATGGCAGAGCATATAAGGTGCGGTAGGATTAGTTGCTCCTCACATTAGCTTCTGGCATAG

               70        80        90       100       110       120

     

glo,   T

       X

R9,    T

       

>>R7, 121 bases, BC9B2289 checksum.                  (121 nt)

initn:  453  init1:  453  opt:  470

  87.6% identity in 121 nt overlap

 

               10        20        30        40        50        60

glo,   CGTAGAGCCACACCCTGGTAAGGGCCAATCTGCTCACACAGGATAGAGAGGGCAGGAGCC

       ::: :: X::::::::::::  :::::::::::::::: ::::: ::: ::: :: ::::

R7,    CGTTGACCCACACCCTGGTAGCGGCCAATCTGCTCACAGAGGATCGAGTGGGGAGTAGCC

               10        20        30        40        50        60

 

               70        80        90       100       110       120

glo,   AGGGCAGAGCATATAAGGTGAGGTAGGATCAGTTGCTCCTCACATTTGCTTCTGACATAG

        ::: ::: : :::::::::::::::: :::::: :::::::::::::::::::::::::

R7,    TGGGTAGATCGTATAAGGTGAGGTAGGCTCAGTTCCTCCTCACATTTGCTTCTGACATAG

               70        80        90       100       110       120

     

glo,   T

       X

R7,    T

       

>>R3, 121 bases, 492F8031 checksum.                  (121 nt)

initn:  461  init1:  461  opt:  461

  86.8% identity in 121 nt overlap

 

               10        20        30        40        50        60

glo,   CGTAGAGCCACACCCTGGTAAGGGCCAATCTGCTCACACAGGATAGAGAGGGCAGGAGCC

       X:::::::::::::::::::::  ::: ::::::::::::::::::::::::::::::::

R3,    CGTAGAGCCACACCCTGGTAAGACCCACTCTGCTCACACAGGATAGAGAGGGCAGGAGCC

               10        20        30        40        50        60

 

               70        80        90       100       110       120

glo,   AGGGCAGAGCATATAAGGTGAGGTAGGATCAGTTGCTCCTCACATTTGCTTCTGACATAG

       : ::  :::::::::::::: ::: :  :::  ::::: ::: ::::::: : :::::::

R3,    AAGGGTGAGCATATAAGGTGGGGTGGCCTCACATGCTCTTCAAATTTGCTGCGGACATAG

               70        80        90       100       110       120

   

glo,   T

       X

R3,    T

       

 

>>R1, 121 bases, ACD08F2C checksum.                  (121 nt)

initn:  450  init1:  450  opt:  452

  86.0% identity in 121 nt overlap

 

               10        20        30        40        50        60

glo,   CGTAGAGCCACACCCTGGTAAGGGCCAATCTGCTCACACAGGATAGAGAGGGCAGGAGCC

       X:::::::::::::::::::::: :::::::: :: :::::::::::::::: : ::::

R1,    CGTAGAGCCACACCCTGGTAAGGCCCAATCTGATCCCACAGGATAGAGAGGGAATGAGCA

               10        20        30        40        50        60

 

               70        80        90       100       110       120

glo,   AGGGCAGAGCATATAAGGTGAGGTAGGATCAGTTGCTCCTCACATTTGCTTCTGACATAG

          ::::::::::: :: :::::::::::: : ::: :::::: ::::::::::::X :

R1,    GACGCAGAGCATATTAGATGAGGTAGGATCGGGTGCCCCTCACTTTTGCTTCTGACAGAT

               70        80        90       100       110       120

                       

glo,   T

       :

R1,    T

       

>>R2, 121 bases, C5BA8B94 checksum.                  (121 nt)

initn:  417  init1:  417  opt:  438

  85.0% identity in 120 nt overlap

 

               10        20        30        40        50        60

glo,   CGTAGAGCCACACCCTGGTAAGGGCCAATCTGCTCACACAGGATAGAGAGGGCAGGAGCC

       ::::: X:::::::: :::: :::::::::::::::::: :: ::::: :::::::::::

R2,    CGTAGCGCCACACCCAGGTATGGGCCAATCTGCTCACACCGGTTAGAGCGGGCAGGAGCC

               10        20        30        40        50        60

 

               70        80        90       100       110       120

glo,   AGGGCAGAGCATATAAGGTGAGGTAGGATCAGTTGCTCCTCACATTTGCTTCTGACATAG

       :::::: ::: :::::::::  : ::::: : : ::::::::   ::::::: ::::::X

R2,    AGGGCATAGCCTATAAGGTGTCGCAGGATTAATGGCTCCTCAGCGTTGCTTCGGACATAG

               70        80        90       100       110       120

      

glo,   T

       

R2,    G

       

>>R5, 121 bases, A7CC5C50 checksum.                  (121 nt)

initn:  363  init1:  363  opt:  401

  82.2% identity in 118 nt overlap

 

 

               10        20        30        40        50        60

glo,   CGTAGAGCCACACCCTGGTAAGGGCCAATCTGCTCACACAGGATAGAGAGGGCAGGAGCC

       X:::::::::::::::: :::::::::::::: :::: ::  :::::::::  : : :::

R5,    CGTAGAGCCACACCCTGTTAAGGGCCAATCTGATCACCCATTATAGAGAGGAAACGGGCC

               10        20        30        40        50        60

 

               70        80        90       100       110       120

glo,   AGGGCAGAGCATATAAGGTGAGGTAGGATCAGTTGCTCCTCACATTTGCTTCTGACATAG

       :::::  : : ::::: :::  : ::: ::::::::::::::::X :: ::: ::::: 

R5,    AGGGCGCACCTTATAACGTGGTGAAGGTTCAGTTGCTCCTCACATCTGTTTCCGACATGC

               70        80        90       100       110       120

       

glo,   T

       

R5,    T

       

>>R8, 121 bases, F8B2CAAC checksum.                  (121 nt)

initn:  365  init1:  365  opt:  380

  79.3% identity in 121 nt overlap

 

               10        20        30        40        50        60

glo,   CGTAGAGCCACACCCTGGTAAGGGCCAATCTGCTCACACAGGATAGAGAGGGCAGGAGCC

       ::: X::::::: :::::: ::: ::::: ::::: ::::::   ::::::::: :::::

R8,    CGTGGAGCCACATCCTGGTGAGGCCCAATATGCTCTCACAGGTCCGAGAGGGCAAGAGCC

               10        20        30        40        50        60

 

               70        80        90       100       110       120

glo,   AGGGCAGAGCATATAAGGTGAGGTAGGATCAGTTGCTCCTCACATTTGCTTCTGACATAG

       :::::::::   ::::  :::::: :: : :::: :::  ::::::::::::X   :: :

R8,    AGGGCAGAGGGCATAAACTGAGGTCGGTTGAGTTTCTCTGCACATTTGCTTCTTCTATTG

               70        80        90       100       110       120

       

glo,   T

       :

R8,    T

       

>>R4, 121 bases, A6543FA4 checksum.                  (121 nt)

initn:  286  init1:  286  opt:  326

  74.4% identity in 121 nt overlap

 

               10        20        30        40        50        60

glo,   CGTAGAGCCACACCCTGGTAAGGGCCAATCTGCTCACACAGGATAGAGAGGGCAGGAGCC

       :::: :: X::::::: ::::::::::::::: :: ::     : :: :  :::: : :

R4,    CGTAAAGACACACCCTTGTAAGGGCCAATCTGTTCTCAAGCTTTCGATATAGCAGAAACA

               10        20        30        40        50        60

 

               70        80        90       100       110       120

glo,   AGGGCAGAGCATATAAGGTGAGGTAGGATCAGTTGCTCCTCACATTTGCTTCTGACATAG

       ::::::  :::: ::   :::   :: :::::::::: :::::::::::::X :  ::::

R4,    AGGGCATCGCATGTAGTCTGACTCAGAATCAGTTGCTTCTCACATTTGCTTCAGGAATAG

               70        80        90       100       110       120

      

glo,   T

       :

R4,    T

Library scan:  0:00:00  total CPU time:  0:00:00

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Table III:

 

No.

-101 to -96 region

-95 to -87 (CACCC box)

-86 to -78 region

-77 to -72 (CCAAT box)

-71 to -31 region

-30 to -26 (TATA box)

-25 to cap site

Below cap site

 

 

 

 

 

 

 

 

 

R1

_

_

-78GC*

_

-69CA

-66AC

-49CA

-47GT

-41AG

-40GA

-39GC

-27AT

-24GA

-11AG

-9TG

-5TC

+3AT

+17TG

+19GT

 

 

 

 

 

 

 

 

 

R2

-96AC

_

-86TA

-81AT

_

-62AC

-59AT

-53AC

-35GT

-31AC

_

-21AT

-20GC

-18TC

-12CT

-10GA

-8TG

+2CG

+3AC

+4TG

+12TG

 

 

 

 

 

 

 

 

 

R3

_

_

-78GC

-79GA

-74AC

-40GA

-37CG

-36AT

_

-21AG

-17AG

-15GC

-14AC

-10GC

-9TA

-3CT

+2CA

+10TG

+12TG

 

 

 

 

 

 

 

 

 

R4

-97GA

-94CA

-85GT

_

-69CT

-66AT

-63CA

-62AG

-61GC

-60GT

-59AT

-57AC

-54GT

-52GT

-51GA

-46GA

-44GA

-42CA

-35GT

-34AC

-29AG

-26AG

-25GT

-24GC

-20GC

-19GT

-18TC

-15GA

-4CT

+12TA

+14AG

+15CA

 

 

 

 

 

 

 

 

 


Table III continued…

 

No.

-101 to -96 region

-95 to -87 (CACCC box)

-86 to -78 region

-77 to -72 (CCAAT box)

-71 to -31 region

-30 to -26 (TATA box)

-25 to cap site

Below cap site

 

 

 

 

 

 

 

 

 

R5

_

_

-84GT

_

-69CA

-64AC

-61GT

-60GT

-50GA

-49CA

-47GC

-45AG

-36AG

-35GC

-33GC

-31AT

 

_

-25GC

-21AG

-20GT

-18TA

-14AT

+5TC

+8CT

+12TC

+18AG

+19GC

 

 

 

 

 

 

 

 

 

R6

_

_

-79GC

_

-62AT

-60GT

-46GA

-38GA

_

_

+20TG

 

 

 

 

 

 

 

 

 

R7

-98AT

-95GC

-81AG

-80GC

_

-63CG

-57AC

-53AT

-49CG

-46GT

-41AT

-37CT

-33GT

-31AG

_

-14AC

-7GC

_

 

 

 

 

 

 

 

 

 

R8

-98AG

-89CT

-82AG

-78GC

-72CA

-66AT

-59AT

-58TC

-57AC

-47GA

-32CG

-31AG

-30TC

-25GA

-24GC

-17AC

-14AT

-12CG

-7GT

-3CT

-2TG

+13GT

+14AC

+15CT

+18AT

 

 

 

 

 

 

 

 

 

R9

-101CT

-94CG

-88CG

-86TG

-84GT

-83TG

-79GA

_

-51GC

-40GT

_

-21AC

-12CT

+6TA

+14AG

 

 

 

 

 

 

 

 

 

R10

-101CA

-98AT

-97GA

_

_

_

-56GC

-51GT

-46GA

-41AG

_

_

+14AT

 


 



* -78GC indicates that G at -78 position is mutated by C.